Human Variation & Race Blog Post

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis. (5 pts)
I have chosen the environmental stress of cold temperature. This environmental stress negatively impacts the survival of humans by disturbing homeostasis. Human can maintain a stable core body temperature but when extremely cold climates arrive, human can develop hypothermia. Hypothermia is a life threatening drop in core body temperature to subnormal levels. The humans normal body temperature is 98.6 degrees Fahrenheit with the exceptions of being one degree less or more depending on hormone levels, physical activity, and the time of day. So when the humans core body temperature drops below 94 degrees this is when hypothermia occurs. Lower then 85 degrees the humans body cools down more rapidly resulting in death.

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total)






 A short term stress humans have adapted to the environmental stress of cold is shivering to maintain homeostasis. Shivering is an early sign to indicate hypothermia.

 A facultative adaptation humans have adapted to the environmental stress of cold is  intermittent Vasoconstriction. This is when the blood vessels narrow to reduce blood flow to the skin. In order to retain body heat blood vessels constrict thus blood flow is restricted.

 A developmental adaptation humans have adapted to the environmental stress of cold is body shape. Humans who live in colder temperatures tend to have more body mass or be more round and squat. Humans also tend to gain more body fat around their bodies core.

 A cultural adaptation humans have developed to the environmental stress of cold is clothing attire. Different cultures wear more heavier, warmer clothing as well as more layers. Also the use of the heater and making a fire can keep you warm. Some cultures even drink strong alcohol to help regulate their bodies core temperature.







 3. What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way. (5 pts)
The benefits of studying human variation is the value of the important facts and information we now know of to be better prepared when we undergo extreme temperatures or climates. For example, my cousin lives in Colombia. Colombia is a country in South America near the equator. He is used to the heat and humidity. My cousin wears thin material t shirts and shorts. Sometimes he wears his shirt on his head like a hat when he is sweaty. He also drinks plenty of water and stays thin. If my cousin would move to Alaska or some other country up north he wouldn't survive if he stays with the accustoms of living near the equator. It is wise to study human variation.

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. (10 pts)
I would use race to see the long term environmental stressors. Such as skin color being adapted to environment. Darker skin tones have more melanin whereas lighter skin tones can get skin cancer when exposed to harsh sunlight. Of course over time different human race have traveled the world and been living in different environments then from where they originated but you can see these various adaptations. That is why it is better to study environmental influences on adaptations because no matter what your race is we all experience the same adaptations to our environment.

Language

Jennifer Hernandez

An interesting fact I found in the National Geographic News was that an FOXP2 “the speech and language gene” was found by a team of European researchers from Neandertal bones they recovered  from a Spanish cave. This gene is said to be the same as that of modern humans. So when conducting the language experiment test, it was really difficult to communicate my ideas, points, and thoughts without speaking, writing, or using ASL. It was virtually impossible to conduct without the other person knowing I was conducting an experiment. So, I did the experiment with my sister. I did not tell her about the experiment. In order to engage in a conversation, I began by entering the kitchen where my sister was cooking. When she asked me to help her, I smiled and jumped right in. If I were able to speak I would say “ofcourse! What do you want me to do first?” or “yes! What are you cooking?” However, I was not able to talk because I was experimenting. When she said “thanks, I needed the extra hand,” I just smiled again. Then she asked “how’s school?” so I looked at her and made a weird face expression. I think she caught on right away because she asked “what is the matter? Are you not feeling well today?” So I shook my head, and she told me to go lay down and drink some medicine. So this experiment didn’t work out. I tried the experiment again but at work and my coworkers thought I was sick as well. So, no matter who I was conducting the experiment with they thought I was sick. I think my sister and co workers had the power in the experiment because they were the ones talking and asking questions to find out what was the matter. Now, usually when conversating the conversation would be equall with both of us talking and responding. However, my sister didn’t even try talking to me or altering her way of speaking because she thought I was sick and the same with work. So this experiment was difficult and I felt bored and alone because my sister sent me to my room, and my co workers stayed away.

The one in control of the conversation was my sister because she was the one who started the conversation, asked the questions, and even answered the questions she was asking. She initiated the conversation by asking me to help her cook, then by asking how school was going, then by asking if I was sick. When conducting the experiment at work with a group of people, I was also not in control of the conversation. They asked questions to find out what was wrong but ended up with the conclusion that I was sick. So when they conversed I was left out, but that was okay because I was conducting an experiment for 15 minutes. I did tell them and my sister after 15 minutes passed what I was doing. After that everything went back to normal. I was able to communicate the only way I know how and that is by talking.

When envisioning communicating with someone from a different culture who doesn’t use spoken language, I would think they would have the upper hand in communicating complex ideas within their own population. If I were to enter that different population, I would not be able to communicate complex ideas because I would just look unusual. I think their shouldn’t be any attitudes or disrespect towards any one different from yourself. Everyone communicates differently and has their own beliefs, ideas, and differences. Two different cultures may be a population that speaks English, Spanish, Chinese, French etc… and a population who doesn’t use language to communicate would be one that wears different clothes and adornments to communicate such as New Guinea.

When conducting the second part of the experiment and reframing of using any physical embellishments, hand signals, vocal intonation, head, facial, or body movements, the experiment was a complete failure. I conducted this experiment on my mom. She thought something had happened to me or I saw something horrific. I conducted this experiment at home first thing in the morning. My mom would come into my room in the morning to see if I was awake to go to school or work. That morning I got up extra early and sat in the living room couch. My mom was looking everywhere for me until she turned on the lights and saw me sitting down on the couch. She let out a scream and yelled what I was doing all alone in the dark. I did not move or smile or speak. She asked several questions then when she didn’t receive a response from me she began to pray. Now, I began to get frightened because of all those scary movies I have seen of a possessed human and religion being the savior. I ended the experiment and ran to hug my mom. I told her what I was doing and we both laughed and she told me to never do that again that I frightened her.

By conducting this experiment, it says that the use of signs is rather very important in communicated effectively. When someone reads your body language it can say a thousand things. Our body language expresses our personalities, our sexuality, and whether we are aggressive, assertive, or passive. Our body language can either welcome someone to speak with you or run/stay away.

I think that the adaptive benefit to reading body language goes a long way to discovering so much about that person. You can see truth and lies as well. It is beneficial for surviving, obtaining resources, and reproducing successfully. In the society I live in, interpersonal skills and body language plays a crucial role in landing that one job you have been seeking. Getting the job means earning money to survive in life, meaning being able to obtain resources such as paying for housing, food, clothes, and more to keep up with today’s society of advanced technology etc.

Someone who can read body language would be a psychologist since body language reveals underlying feelings and attitudes. Someone who might have trouble understanding your body language would be someone from a different culture who comes from a different country than your own. Body language is completely different in many countries. Body language is not a science and is not universally the same for everyone. A situation where body language does not give me reliable information would be in a conversation to get points, ideas, and facts across. Body language alone can not communicate those ideas. Without words, body language is not that useful. We need words and body language to completely understand.

Piltdown Hoax Assignment

      In the early 1900's a hoax had scientist fooled for more than 40 years. In 1912 near the southern English town of Louis village of Piltdown archeologist Charles Dawson was digging in a gravel pit and claimed to have found a piece of an ancient human scull. He invited geologist Arthur Smith Woodward and a French paleontologist father Pierre Teilhard de Chardin to join him at Piltdown. This had all scientist fooled because they believed it was the missing link between humans and apes. It also backed up England's leading anatomist Arthur Keith's theory of human evolution that humans developed big brains before they walked up right.

      When scientists have national pride or self interest science becomes obscured and we can not rely on it. Scientists can lie, cheat, and deceive us. Those are the human faults that came into play with the Piltdown hoax. The scull of a female orangutan was made to be believed as human by staining and filing down the teeth. Scientists believed it and used it as the missing link between humans and apes which can negatively impact the scientific process because it is not true.

      Positive aspects of science are the remarkable technology used. In 1949 scientist conducted a fluorine measurement on the Piltdown fossils and discovered that the fossils were young, only 100,000 years old. In 1953 scientist launched a full scale analysis with better dating methods. The stains on the bones were superficial and the teeth were filed down using a steel knife. The bones came from a female orangutan. This science helped unravel the Piltdown man hoax that had everyone fooled for many years.

      So, is it possible to remove the human factor from science to reduce the chance of errors like this happening again? I don't think the human factor can be removed. It has been used for many decades and to simply just remove it will not make sense. Mistakes happen in everyone's life's. The Piltdown Hoax had everyone fooled but was later discovered to be false. It was a humans faulty mistake to do such a hoax but it also was humans remarkable intelligence to figure out the hoax. I would not remove the human factor from science.

      The life lesson I can take from this historical event regarding taking information at face value from unverified sources is to not believe. I shouldn't believe in anything until I do extensive research. Such as the Piltdown hoax having everyone fooled for many years because the technology was not good enough yet to research the scull and verify how old it was. With research one can discover and learn many interesting and extraordinary happenings. 

Week 4: Comparative Primate Blog Post

1. chosen primates (with their grouping in parentheses):

Lemurs (Prosimians/Strepsirhini)
Spider Monkey (New World Monkey/Platyrrhini)
Baboon (Old World Monkey/Cercopithecidae)
Gibbon (Lesser ape/Hylobatidae)
Chimpanzee (Great ape/Hominidae)


2. H : Dentition patterns
3. For each of the five primates you will provide four sets of information:
a. A thorough description of the environment in which the primates lives. (10 pts total)
Lemurs, live on an island called Madagascar. It is an island on the southeast coast of Africa. The weather is at times really dry and cold or humid and rainy. The environment is heavy with trees where they spend most of their time.
Spider Monkeys live in the tropical rain forests of Central and South America.
Baboons live in Africa and or Arabia. They mostly reside in large grassy areas or areas that are moist with evergreen trees.
Gibbons live in the forests of Southern Asia.
Chimpanzees can be found in Africa. They can live in various habitats such as rainforests, woodlands, and swamp forests.

b. A description of your specified character trait for that primate. (10 pts total)
Lemurs: The dentition pattern of the lemur is 2-1-3-3 which is incisors-canine-premolars-molars. The Lemur has smaller teeth due to their diet.
Spider Monkey: The dentition pattern of the Spider Monkey is 2-1-3-3 The Spider Monkey has smaller teeth due to their diet.
Baboons: The dentition pattern of the Baboon is 2-1-2-3. Uses their teeth to intimidate others. Baboons have the largest teeth of all primates.
Gibbon: The dentition pattern of the Gibbon is 2-1-2-3. Uses their teeth to intimidate others.
Chimpanzee: The dentition pattern of the Chimpanzee is 2-1-2-3. Uses their teeth to intimidate others.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment. (10 pts total)
Since all of these primates consume most of their time in trees their dentition pattern is adapted to fit their diet that is found in their environment and trees. Lemurs also use their teeth to clean and groom themselves. So their teeth are constantly shaved down. Whereas the Baboons, Gibbons, and Chimpanzees eat small animals and insects so their teeth tend to be larger.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total)

Lemur

 

Spider Monkey

Baboon

Gibbon

Chimpanzee

 

　 4. Summarize your findings, evaluating the level of influence the environment has on the expression of physical and behavioral traits. (15 pts)
The Dentition pattern of these primates are closely match with each having incisors, canines, premolars, and molars. The Lemur and Spider Monkey dentition pattern are the same 2-1-3-3. Lemurs eat lots of plants whereas the Spider Monkey eats fruits, wild eggs, plants, and seeds. The Baboon, Gibbon, and Chimpanzees dentition pattern are 2-1-2-3.These primates are omnivorous, consuming both plants and animals so that is why their teeth are larger than that of the Lemurs and Spider Monkey. All of these primates live in an environment rich in plants and trees and adapt to survive in these environments.

Analogy/Homology Blog Post


1. For your homologous traits provide the following information (25 pts):
a. Briefly describe the two different species that possess the homologous trait. (5 pts)
Two different species that possess the same traits are the skeletal structure of a human and bat.

b. Describe the homologous trait of each species, focusing on the differences in structure and function of the trait. Why do these homologous traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)
The arms of a human is covered in skin whereas the bat is covered in hair. They both possess the same forearm bones but use them differently. The bones they both possess are the humerus, ulna, radius, carpals, metacarpals, and phalanges. The human arms are used for many things and a bats is used to fly. A human can not fly.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait? (5 pts)
There is no common ancestor for these two species. The humans ancestor is the primate and the bats ancestor is a rat.


d. Provide an image of each species in this comparison. (5 pts)
Bat image

Human image

 

 

2. For your analogous traits provide the following information (25 pts):
a. Briefly describe the two different species that possess the analogous trait. (5 pts)
Two different species that possess the analogous trait are butterfly's and honeybees. Their mouth parts which are the proboscis of the butterfly and the proboscis of the honeybee.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)
The butterfly proboscis is a slender tubular mouth piece used to eat. The butterfly is able to suck nectar out of flowers. The butterfly's proboscis is sharp and has it curled between his palpi. The honey bee proboscis is long, slender, and hairy which is the tongue. it is also used to suck its food. It's proboscis is hidden behind its head. The honey bee uses his proboscis to suck pollen out of flowers. These two have differences because they are from different insect families. The butterfly is from the Lepidoptera class. The honeybee is from the genus Apis.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts)
There's no common ancestor between the honeybee and butterfly only that they are both insects and have evolved to fit their environment.

d. Provide an image of each species in this comparison. (5 pts)
Honeybee image

 

Butterfly image

 

Human image

Jennifer Hernandez
Anthro 101
Week 2 Protein Synthesis Blog Post


ACCTTACACCCTTTAAGACGTCTGAACATCTATCTAGC

Historical Influences On Darwin Assignment

Create a new blog post that accomplishes the following (Due Thursday by 11:59 pm)

1. Select one of the five individuals listed above who you would argue had the most influence over Darwin’s development of his theory of Natural selection. This could be a positive or a negative influence.

Jean- Baptiste Lamark, best known for his theory of the inheritance of acquired characteristics, and Georges Cuvier, best known for his proposed doctrine of catastrophism, where some scientist Darwin became familiar with while attending Edinburgh University. Thomas Malthus had an enormous influence on both Charles Darwin and Alfred Russel Wallace, however, Malthus was not interested in species change at all. Then, there is Charles Lyell, who was Charles Darwins friend and mentor, he was a great geologist and changed the framework of scientific views on the geological past. Then, there is Alfred Russel Wallace who I believe had the most influence over Darwins development of his theory of Natural Selection.

2. Briefly (but completely) describe the contribution this individual made to the scientific community. You must provide one link to an online source of information besides your textbook. No Wikipedia sources! ( 10 pts)

The publication in 1855 of Alfred Russel Wallace article of species caused the scientific community to push Darwin in publishing his theories. When Wallace sent Darwin his other paper “On the Tendency of Varieties to Depart Indefinitely from the Original Type” in 1958 it pushed Darwin even more to write his theories on Natural Selection so that he can get credit for his work before Russel did. This is when Darwin published “On the Origin of Species,” one of his greatest work.

http://www.alfredwallace.org/

3. From the bullet point list above (under “How does evolution work?”), identify the point (or points) most directly affected by this individual’s work and thoroughly explain how this point was influenced by your selected individual. Again, this could be a positive effect, meaning Darwin built upon the knowledge this information provided, or a negative effect, meaning that Darwin demonstrated that this individual’s idea(s) were incorrect and the mechanism of natural selection was an alternative explanation. (10 pts)

· In order for natural selection to occur, reproduction MUST occur! Survival is not enough. If you don’t pass on your traits, evolution will not occur.

Alfred Russel Wallace identified natural selection as the key to the evolutionary process. Alfred simply wanted to know answers and truths to the natural world. Wallace and Darwin’s ideas were quiet different and Darwin proved to be the one on top.

4. Could Darwin have developed his theory of natural selection without the influence and ideas of this individual? Explain. (10 pts)

I believe Darwin was capable of developing his theory of natural selection without the influence and ideas of Alfred Russel Wallace but without him he would not have been pushed to create and publish his greatest work “On the Origin of Species.” These two scientists competed with one another in getting their theories published first before the other was given credit.

5. How did the attitude of the church affect Darwin and his eventual publication of his book On the Origin of Species? (10 pts)

Of course, the attitude of the church would be hostile and opposed to Darwin and his publication of his book “On the Origin of Species.” At first, Darwin was unsure of whether he wanted to publish his work because of the many negative religious views he would encounter. However, his own influences and knowledge persuaded him more than the outcome of the churches attitude would be towards his work.

Make at least two significant, constructive responses to blog posts of your fellow students, provided positive and/or constructive feedback. (Due Friday by 11:59 pm – 5 pts each)